Agrobacterium-mediated transformation of Nicotiana tabacum by disarmed strain at 699 resulted in considerable raising of growth and development of transgenic plants
Author: Maximova L.A., Nurminskaya J.V., Kopytina T.V., Enikeev A.G.
Journal: Журнал стресс-физиологии и биохимии @jspb
Article in issue: 1 т.8, 2012.
Free access
The question how long transgenesis invected alterations are demonstrated in a succeeding generations remains of great interest. In this study we describe the development of T1-T5 generations of Nicotiana tabacum L. transformed by Agrobacterium tumefacience strain 699 with disarmed plasmid. Tobacco plants were grown in the same environmental conditions. The characteristics of vegetative and generated parts had been assessed. Transgenic plants were superior to normal ones in leaf area and stem length, had earlier flowering and internodes development but not differ in a number and size of flowers. Growth activation is suggested to be a result of biotic stress induced by transformation
Nicotiana tabacum, disarmed strain, transgenic plant, development, t1-t5 generations
Short address: https://sciup.org/14323581
IDR: 14323581
Text of the scientific article Agrobacterium-mediated transformation of Nicotiana tabacum by disarmed strain at 699 resulted in considerable raising of growth and development of transgenic plants
Although there are numerous investigating of the post-transgenesis effects, much less is known about ones after transformation with disarmed vector which sometimes reveals unexplainable results. It was found that in some cases plants transformed with disarmed plasmid had resistance to pests like Bt-plants (Bogomaz, 2005), the altered reactions to the selective light (Efimova et al., 2010) or had no any visible effects (Maximova et al., 1998; Cui, Ezura, 2003). Another question arises, how long will these allogenetic features continue to persist? Frequently, presented data are limited to cell cultures or to early stages of T0-T1 generations without detailed description of development, so the ontogenesis and physiology of mature transgenic plant in many instances are unclear till now. The objective of this work was to assess some morphochronometric characteristics of development of successive T1-T5 generations of tobacco plants, transformed with disarmed strain A.tum.699.
MATERIALS AND METHODS
Agrobacterium-mediated transformation
Transgenic lines of Nicotiana tabacum L. have been obtained by agrobacterium transformation of leaf disks. The vector pCNL 65 with npt gene in disarmed strain Agrobacterium tumefaciense 699 ( A.tum. 699) was used for plant transformation. The procedure of transformation, regeneration and selection of T 0 generation carried out according to method (Draper, 1991).
To make sure of transgenic status of kanamycin selected tobacco lines the PCR analysis (Fig.1) was performed. Primers to npt gene:
5ґ… ATGACTGGGCACAACAGACCATCGGCT
3ґ… TACTGACCCGTGTTGTCTGGTAGCCGA.
Line №1 was used for plant regenerations and following T 1 -T 5 generations producing.
Tobacco plants which had no contact with A.tum. 699 were defined as normal or control plants.
Plant material
Tobacco plants were grown in greenhouse at 15°C night and 25°C day temperature and received a 16-hour natural daylight. Each plant grew in individual vessel filled with peat of the same humidity and nutrient’s content.
Measurements and Statistics
Following plant characters were measured:
leaf area (weekly); number of flowers per plant (daily); stem and internodes length (after harvesting); flower parts (10 flowers from each plant were fixed in acetic acid and ethanol mixture (1:3) and then were incised into corolla, pestle and stamens, placed on glass and measured. Measurement error was 2.76%. Time scale represented a number of days after sowing.
In all figures (excluding Fig.5), data are represented by box plots with M (mediana), IQR (interquartile range) and limits. N=6. To test the statistical significance of the differences, Wilcoxon test was used (p<0.05) (Glantz, 1999).
RESULTS AND DISCUSSION
Transgenic plants (TP) demonstrated enhanced vegetative parameters compared with normal plants (NP). TP flowered earlier than the NP by 10-13 days (Fig.2) and produced longer stems (Fig.3). Nevertheless, period of flowering time was substantially equal (Fig.4).
TP had increased total leaf area as compared to controls (Fig 5). The diagram demonstrates the rate of development of total leaf area of TP which was more intensive then one of NP. For example, the total leaf area of T 4 plants exceeded NP more than twofold.
The flower organ’s measurements showed no significant differences between all TP generations and NP (Fig.6-9). Only T 1 plants have stamen length more then normal one (Fig.8,9).
Figure 1 . The amplification of npt gene in transgenic tobacco lines.
1,9 – control ( nontransgenic plants); 2-8 – transgenic tobacco lines; 10 – marker 1000 b.p;
11 – positive control (plasmid DNA from A . tum .699); 12 – negative control.
Figure 2 . Effect of transformation on flower initiation of tobacco plants for succeeding generations. T 1 -T 5 plant generations are compared. * - significantly different from the control (p<0.05)
Figure 3 . Effect of transformation on stem length of tobacco plants for succeeding generations. T 1 -T 5 plant generations are compared. * - significantly different from the control (p<0.05)
Figure 4 . Effect of transformation on duration of flowering of tobacco plants for succeeding generations. T1-T5 plant generations are compared. No significant differences from the control.
-♦-Normal -и-Tl ^T2 ^T3 ^T4 ^T5
Figure 5 . Effect of transformation on total leaf area’s development of tobacco plants for succeeding generations. T1-T5 plant generations are compared. Values represent mean (±SE not indicated) * - significantly different from the control (p<0.05)
Figure 6 . Effect of transformation on flower size (corolla) of tobacco plants for succeeding generations. T1-T5 plant generations are compared. No significant differences from the control.
Figure 7 . Effect of transformation on flower size (pistil) of tobacco plants for succeeding generations. T1-T5 plant generations are compared. * - significantly different from the control (p<0.05)
Figure 8 . Effect of transformation on flower size (minor stamen) of tobacco plants for succeeding generations. T 1 -T 5 plant generations are compared. * - significantly different from the control (p<0.05)
Figure 9 . Effect of transformation on flower size (major stamen) of tobacco plants for succeeding generations. T 1 -T 5 plant generations are compared. * - significantly different from the control (p<0.05)
Figure 10 . Effect of transformation on a number of seed vessels per plant of tobacco for succeeding generations.
T 1 -T 5 plant generations are compared. No significant differences from the control.
No significant alterations were found in a number of seed vessels between the transgenic plants and the untransformed control plants. Nevertheless, the number of seed vessels of TP was visibly less than one of NP (Fig.10). Thus, our analysis of morphochronometric peculiarities of normal and transformed tobacco plants showed that TP had earlier development and increased vegetative characteristics. Therefore, to provide this, they must have an enhanced biosynthesis of hormones, proteins, lipids, hydrocarbons et cetera, and have an additional pool of constituents; in other words, they will have enhanced metabolism. It is known that plants have a great potential for yield that is commonly unrealized because of insufficient adaptation to unfavorable environment (Boyer, 1982). But our results showed that at the same environmental conditions TP exhibited a stem length and leaf area 2–3 times greater compared to NP at maturity.
What are the sources of observed alterations in transgenic plants? Where and why plants keep metabolic reserves close? Disarmed agrobacterial strains used for transformation did not contain any sense sequences directly associated with plant metabolism like genes of biosynthesis of phytohormones, fat acids, oxidative enzymes etc (de Boer et al., 1999; Tsabary et al., 2003; Cecchetti et al., 2004; O’Hara et al., 2007). Among the numerous studies on a plant transgenesis there are the repots describing effects which can’t be explained by action of inserted gene (Abdeev et al., 2005; Karnachuk et al., 2008; Zagorskaya et al., 2009; Pryadyohina et al., 2010; Puzina et al., 2010). So there should be another cause for such events. Many authors point to the elevations of antioxidant content, POL, activity of oxidative enzymes in transgenic plants (Doubnerová et al 2007; Zhenqiang et al, 2007; Wei et al, 2007) . These alterations are like nonspecific stress response (Gaspar et al., 2002). We interpret these responses as a consequence of contact with Agrobacterium and a transformation procedure. Agrobacterial transformation is considered to be a complex multilevel biotic stress factor including reactions on the wounding, contact with pathogen, culturing in vitro and T-DNA insertion (Enikeev, 2008). Thus, relevant alterations in phenotypes of the transgenic plants are assumed to be more likely related to the stress-reaction after agrobacterial transformation. The majority of transgenic plants studies to date have been performed using tissue cultures or whole organisms that were sampled at an early developmental stage. Thus, considerable information on post-transformation growth and development is lost. Our results showed that first T-generations demonstrated clearly increasing plant size but then tended to decrease, returning to origin; T5 was generally similar to control plants. It is remarkably, vegetative characters appeared more sensitive and reactive to stress. Evidently, flower as a generative organ is evolutionally more defended because of relevancy to keep its structure stabile.
Based on these results, it was suggested that effect of growth and development stimulation after agrobacterial transformation `had similarity with I st phase of the adaptation strain (Selye, 1936) and also is accompanied by releasing of hidden metabolic reserves. Causes and details of this phenomenon are appeared to be of great interest and further investigations of the plant metabolism potential need to be continued.
References Agrobacterium-mediated transformation of Nicotiana tabacum by disarmed strain at 699 resulted in considerable raising of growth and development of transgenic plants
- Abdeev, R.M., Musiichuk, K.A., Goldenkova, I.V., Sotchenkov, D.V., Salekhi Dzhuzani, G.R., Alyavina, A.K., Zagoskina, N.V., Piruzian, E.S. (2004) Morphology and Phytohormone Content in Transgenic Tobacco Plants Expressing Bacterial Thermostable Cellulase. Rus. J. of plant Physiol., 5, 642-647
- de Boer, G.-J., Testerink, C., Pielage, G., Nijkamp, H.J., Stuitje, A.R. (1999) Sequences surrounding the transcription initiation site of the Arabidopsis enoyl-acyl carrier protein reductase gene control seed expression in transgenic tobacco. Plant Mol. Biol., 6, 1197-1207
- Bogomaz, D.I. (2005) Analysis of interaction of plant genotype and strain Agrobacterium tumefaciens in breeding of potato resistance to Colorado potato beetle Rus. J. of Genet.: Appl. Research, 1, 34-41
- Boyer, J.S. (1982) Plant productivity and environment. Science, 4571, 443-448
- Cecchetti, V., Pomponi, M., Altamura, M.M., Pezzotti, M., Marsilio, S., D'Angeli, S., Tornielli, G.B., Costantino, P., Cardarelli, M. (2004) Expression of RolB in tobacco flowers affects the coordinated processes of anther dehiscence and style elongation. The Plant Journal, 3, 512-525
- Cui, M., Ezura, H. (2003) Agrobacterium-mediated transformation of Nemesia strumosa Bemth, a model plant for asymmetric floral development. Plant Sciense, 165, 863-870
- Draper, J., Scott, R., Armitage, P., Walden, R. (1991) Genetic engineering of plants. Laboratory Handbook. -Moscow, Mir
- Doubnerova V., Janoskova M., Synkova, H., Subr, Z., Cerovska, N., Ryslava, H. (2007) Effect of Potato virus Y on the activities of antioxidant and anaplerotic enzymes in Nicotiana tabacum L. Transgenic plants transformed with the gene for p3 protein Gen. Appl. Plant. Physiology, 33, 123-140
- Efimova, M.V., Karnachuk, R.A. Lapuhina, O.V., Kuzmetsov V.V. (2010) Peculiarities of development of Arabidopsis thaliana (L.) HEYNH seedlings under the selective light. Proc. of 3rd All-Russian Symp. on Physiology of transgenic plants and biosafety, Moscow, Russia, 18-21 Oct., 46
- Enikeev, A.G., Kopytina T.V., Semenova, L.A., Natyaganova, A.V., Gamanetz, L.V., Volkova, O.D. (2008) Agrobacterial transformation as a complex biotical stressing factor. Journal of Stress Physiology & Biochemistry, 4, 11-19
- Gaspar, T., Franck, T., Bisbis, B., Kevers,C., Jouve, L., Hausman, J.F., Dommes, J. (2002) Concepts in plant stress physiology. Application to plant tissue cultures. Plant Growth Regulation, 37, 263-285
- Glantz, S.A. (1999) Primer of biostatistics. McGraw-Hill Professional, New York
- Karnachuk, R.A., Gvozdeva, E.S., Efimova, M.V. (2008) Photoregulation of morphogenesis of tobacco plants transformed with the gene of human interlenkin-18. Rus. J. of Plant Physiol., 4, 503-506
- Lu, Z.Q., Liu, D.L. and Liu, S.K. (2007) Two rice cytosolic ascorbate peroxidases differentially improve salt tolerance in transgenic Arabidopsis. Plant Cell Rep, 26, 1909-1917.
- Maximova, S.N., Dandekar, A.M., Guiltinan, M.J. (1998) Investigation of Agrobacterium mediated transformation of apple using green fluorescent protein: high transient expression and low stable transformation suggest that factors other than TDNA transfer are ratelimiting, Plant Mol. Biol., 37, 549-559
- Nobuhiro Kotoda, Masato Wada, Shinnosuke Kusaba, Yuriko Kano-Murakami, Tetsuo Masuda, Junichi Soejima (2002) Overexpression of MdMADS5, an APETALA1-like gene of apple, causes early flowering in transgenic Arabidopsis, Plant Science, 162(5), 679-687
- O'Hara, P., Slabas, A.R., Fawcett, R. (2007) Antisense expression of 3-oxoacyl-asp reductase affects whole plant productivity and causes collateral changes in activity of fatty acid synthase components. Plant and Cell Physiology, 5, 736-741
- Pryadyohina, E.V., Lapshin. P.V., Nechaeve, T.L., Yurieva, N.O., Zagoskina, N.V. (2010) Some physiological and biochemical characteristics of transgenic potato lines, which differ by a level of gene expression. Proc. of 3rd All-Russian Symp. on Physiology of transgenic plants and biosafety, Moscow, Russia, 18-21 Oct., 67
- Puzina, T.I., Kirillova, I.G., Korol, V.V. (2010) Hormonal state particularities of apical meristems of potato tubers, transformed Bt-gene and gene of defensine. 3rd All-Russian Symposium Physiology of transgenic plants and biosafety, Moscow, 68
- Selye, H. (1936) A Syndrome Produced by Diverse Nocuous Agents. Nature, 138, July 4, p. 32.
- Tsabary, G., Shany, Z., Roiz, L., Levi, I., Riov, J., Shoseyov, O. (2003) Abnormal 'wrinkled' cell walls and retarded development of transgenic Arabidopsis thaliana plants expressing endo-1,4-glucanase (cel1) antisense. Plant Mol. Biol., 2, 213-224
- Zagorskaya, A.A., Sidorchuk, Yu.V., Shumnyi, V.K., Deineko, E.V.(2009) Dynamics of IAA and cytokinins in flower tissues of transgenic tobacco mutant plants with mutant phenotype. Rus. J. of Plant Physiol., 6, 830-837
- Wei Feng Xu, Wei Ming Shi (2007) Mechanisms of salt tolerance in transgenic Arabidopsis thaliana constitutively overexpressing the tomato 14-3-3 protein TFT7. Plant Soil, 301, 17-28