Differential of PAL and PR2 expressions in barley plants challenged with seed (Pyrenophora graminea) and soil-borne (Cochliobolus sativus) fungal pathogens
Автор: Al-Shehadah Eyad, Alek Huda, Jawhar Mohammed
Журнал: Журнал стресс-физиологии и биохимии @jspb
Статья в выпуске: 4 т.18, 2022 года.
Бесплатный доступ
The seedborne Pyrenophora graminea and the soilborne Cochliobolus sativus are economical fungal pathogens of barley worldwide. To better understand barley mechanisms to resist these two pathogens, expression of two well known defense-related genes PAL and PR2 were monitored in resistant and susceptible barley cultivars at early points of infection using quantitative real-time PCR (qPCR). Data showed significant variance in the expression patterns of both genes between barley P. graminea or C. sativus interactions as compared to the non-inoculated controls. It is also notable that PAL and PR2 genes have a higher expression and faster induction in the resistant cultivar as compared with the susceptible one after infection with each pathogen. However, qPCR analysis revealed higher gene expression in resistant barley plants inoculated with seedborne P. graminea as compared with soilborne C. sativus , with a maximum expression for PAL (15 and 6.8-fold) at 72 hours post inoculation and PR2 (13.2 and 5.3-fold) at 96hpi, respectively. Our data suggest that PAL and PR2 genes , positively regulate P. graminea and C. sativus-resistance in barley plants during disease progress, which can provide useful information for a deeper molecular research on barley defense responses against pathogens with different infection styles.
Barley, defense response, soilborne - seedborne pathogens, rt-pcr
Короткий адрес: https://sciup.org/143179367
IDR: 143179367
Текст научной статьи Differential of PAL and PR2 expressions in barley plants challenged with seed (Pyrenophora graminea) and soil-borne (Cochliobolus sativus) fungal pathogens
Plants have developed immune systems that recognize the presence of fungal pathogens involving seed and soil-borne species and initiate their necessary defense responses. A soil borne pathogen is a disease causing agent which lives both in soil and in a plant host , and has an ability to infect healthy plants growing in that soil. Whereas, a seed borne pathogen is transmitted in embryo which is an essential place for the fungus life cycle. These soil-seedborne pathogens are globally distributed in crops growing area causing significant yield losses (Delgado-Baquerizo et al., 2020; Goko et al., 2021). Therefore, increasing our understanding of the crop resistance mechanisms is required.
Leaf stripe caused by the seedborne pathogen, Pyrenophora graminea S. Ito & Kurib. (anamorph Drechslera graminea (Rabenh. ex. Schltdl.) S. Ito), and common root rot (CRR) caused by the soilborne [ Cochliobolus sativus Drechs. ex Dastur] of barley are among the most devastating fungal diseases causing significant yield losses across the world (Fernandez et al. , 2009; Ghazvini, 2012). Barley plants infected with P. graminea and C. sativus pathogens excite defence response which is regulated by various signalling pathways (Ghannam et al., 2016; Jawhar et al., 2017). Hence, it is highly challenging to control these both pathogens due to a poor understanding of the barley defense mechanisms towards them.
A large number of pathogenesis-related ( PR ) genes are up or down-regulated during plant-pathogen interactions. However, many of their precise roles are still unknown. PR2 is predicted to encode a β-1, 3-glucanase, an enzyme hydrolyzing β-1, 3-glycosidic bonds in β-1, 3-glucans, and has been reported to degrade the fungal pathogen cell wall (Akiyama et al., 2009). In addition, phenylalanine ammonia-lyase ( PAL ) has an essential function in secondary phenylpropanoid metabolism and considered to play a role towards fungal pathogens attack (Hyun et al., 2011). The PAL and PR2 have been found to be involved in the resistance mechanisms towards different plant diseases, such as in rice (Heydari nezhad et al., 2016), soybean (Zhang et al., 2010) and grapevine (Lakkis et al., 2019).
Quantitative PCR (qPCR) would be an efficient technique for measuring the plant relative expression genes after being exposed to biotic stresses, such as infection by fungal pathogens (Derveaux et al., 2010).
We hypothesized that the PAL and PR2 genes could drive contrasted levels of interactions in barley resistant and susceptible genotypes challenged with seed - and soil-borne fungal pathogens. Thus, the present study aimed at evaluating the changes in induction of PAL and PR2 expressions in two barley cultivars infected with different infection styles P. graminea and C. sativus pathogens using qPCR approach.
MATERIALS AND METHODS
Plant Materials
The resistant cv. Banteng and susceptible cv. Furat1 barley cultivars to P. graminea and C. sativus were used in this work (Arabi et al., 2004; Jawhar et al., 2017). ‘Banteng’ is a German cultivar, and ‘Furat-1’ is a local Syrian cultivar.
Inoculation with P. graminea
The most Syrian virulent strain Sy3 (Arabi et al., 2004) was used. The fungus was grown on PDA media and incubated for 7 days at 20 ± 1 °C in the darkness. Inoculation was performed according to Hammouda et al. (1986). Inoculated and control seeds were planted in plastic 20-cm pots filled with sterilized peat moss with five replicates. Each replicate consists of five pots each of ten seeds. Plants were grown under temperature at 12 ᵒC with a daylength of 12 h (Delogu et al., 1989).
Inoculation with C. sativus
The Syrian virulent isolate of C. sativus (Cs16) (Arabi and Jawhar, 2002) was used in the experiments. The fungus was grown on Petri dishes containing potato dextrose agar (PDA, DIFCO, Detroit, MI, USA) for 10 days under 20 °C in the dark. Conidial suspension was adjusted to 2 x 104 conidia/mL. Seeds were inoculated by mixing them thoroughly with a natural Arabic gum (8 drops/L)-peat-conidia inoculums, and 40 ml of spore suspension was mixed in a plastic Petri dish with 50 gr sterile neutralized peat, and planted in pots at a depth of 6 cm to promote long subcrown internodes (Fetch and Steffenson, 1999) in three replicates with 10 seeds per replicate. Based on in vitro preliminary tests on PDA media, CRR-free seeds were used as controls.
RNA isolation and cDNA synthesis
Barley leaves were collected after 24, 48, 72 and 96 hours post inoculation (hpi) with each pathogen. mR A was extracted using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions. R A was used for cD A which was stored at -20 °C. Control samples were collected at each time point from plants spread with pathogen-free water.
Quantitative real time PCR (qPCR)
PAL and PR2 were assayed using SYBR Green Master kit (Roche, USA) according to the method described by Derveaux et al. (2010). The RT-PCR primers sequences are given in Table 1. The fluorescence readings of three replicated samples were averaged, and the blank value was subtracted. The expression levels were measured using the average cycle threshold (Ct). Average Ct values were calculated from the triplicate experiment conducted for each gene, with the ΔCT value determined by subtracting the average Ct value of genes from the Ct value of the EF1α gene as a reference gene. Finally, the equation 2-ΔΔCT was determined as described by Livak and Schmittgen (Livak and Schmittgen, 2001), with EF1α as a reference (housekeeping control) gene. Statistical analysis was performed via the Tukey’s test at the 0.05 level.
RESULTS AND DISCUSSION
In this work, two barley cultivars with different resistance levels to P. graminea and C. sativus infections were used. As shown in Fig. 1, both pathogens caused more severe infection on the susceptible cv. ‘Furat1’ as compared with the resistant cv. ‘Banteng’ one. These results are in agreement with our previous observations under natural field conditions (Arabi and Jawhar, 2002; Arabi et al., 2004).
Further studies of barley interactions with P. graminea and C. sativus by measuring PAL and PR2 expression at four early time points after pathogen challenge, demonstrated that these genes displayed different expressions at P = 0.001 in both barley cultivars, and these expressions were higher and faster induction for both pathogens in the resistant cultivar as compared with the susceptible one (Figures 2 and 3).
Data showed that PCR (qPCR) analysis revealed higher gene expression in resistant barley plants inoculated with seedborne P. graminea as compared with soilborne C. sativus , with a maximum expression for PAL (15 and 6.8-fold) at 72 hpi and PR2 (13.2 and 5.3-fold) at 96hpi, respectively (Figures 2 and 3).
The both genes PAL and PR2 were higher up-regulated in P. graminea inoculated barley plants as compared to C. sativus inoculated plants, which might indicate that these genes might play significant roles in barley resistance against P. graminea which is in line with Ghannam et al. (2016).
It is well known that PR2 encodes glucanase enzyme which hydrolyses the glycosidic bond of glucan in plant cell walls that led to cell wall loosening and expansion (Leubner-Metzger and Meins, 1999). Pecchioni et al. (1999) found that the infection of barley rootlets by P. graminea lead to induce the accumulation of seven PR genes of mR A families. On the other hand, the other gene PAL plays an important role in catalyzing the non-oxidative domination of phenylalanine to trans -cinnamate as a first step in the phenylpropanoid pathway which is an important regulation point between primary and secondary metabolism (Vogt et al., 2010). These events may be the cause of barley cell wall damage during infection with the seed and soilborne pathogens.
The two seed and soilborne pathogens used in this study have several different morphological and biological aspects, such as symptomatology, systemic growth and ability to produce successful secondary infections on barley plants (Porta-Puglia et al., 1986; Kumar et al., 2002). Therefore, we believe that analysis of PAL and PR2 expression might provide useful information for a deeper molecular research on barley defense responses against pathogens with different soil infection styles. Our results are in agreement with previous works in chickpea (Raju et al., 2008) and in grapevine (Lakkis et al., 2019).
Table 1: Properties and nucleotide sequences of primers used in this study
|
Gene |
Gene description |
Sequence |
Amplified fragment (bp) |
|
PAL |
Phenyl alanine amino lyase |
CCATTGATGAAGCCAAAGCAAG ATGAGTGGGTTATCGTTGACGG |
123 |
|
PR2 |
Betal ,3-glucanase2 |
TGGTGTCAGATTCCGGTACA TCATCCCTGAACCTTCCTTG |
193 |
|
EFla. |
Elongation footer-1 Alapha |
TGGAT TTGA GGGTGA С A A CA CCGTTCCAATACCACCAATC |
167 |
Figure 1: Frequency of disease reactions on the barley resistant cv. Banteng and susceptible cv. Furat 1 by P. graminea and C. sativus . Significance at *** P < 0.001 between the cultivars for each disease
Figure 2: Relative expression profiles of PAL gene in the resistant cv. ‘Banteng’ and in the susceptible cv. ‘Furat1’ during the time course following P. graminea and C. sativus infections. Error bars are representative of the standard error (mean ± SD, n = 3). Data are normalized to Elongation factor 1α (EF-1α) gene expression level (to the calibrator, Control 0 h, taken as 0).
CONCLUSION
Seedborne and soilborne diseases pose a significant risk to barley cropping in world. In this work, our data demonstrated that, significant increases in PAL and PR2 expression were found upon barley challenged with the two seed - soilborne fungi P. graminea and C. sativus respectively, with values being consistently higher in plants inoculated with P. graminea. It is also notable that PAL and PR2 have higher expressions and faster induction in the resistant cultivar as compared with the susceptible one. This might be a useful complementary option for the management of these both pathogens in barley.
ACKNOWLEDGMENT
The authors would like to gratefully acknowledge the Director General of AECS and the Head of Molecular biology and Biotechnology Department for their much appreciated help during the period of this research. Thanks are also extended to Dr. A. Al-Daoude for reading the manuscript.
CONFLICTS OF INTEREST
The authors declare that they have no potential conflicts of interest.
Список литературы Differential of PAL and PR2 expressions in barley plants challenged with seed (Pyrenophora graminea) and soil-borne (Cochliobolus sativus) fungal pathogens
- Cairns JRK. 2009. Expression of an endo-(1,3;1,4)-beta-glucanase in response to wounding, methyl jasmonate, abscisic acid and ethephon in rice seedlings. J. Plant Physiol., 166, 1814-1825.
- Arabi MIE, Jawhar M. 2002. Virulence spectrum to barley in some isolates of Cochliobolus sativus from Syria. J. Plant Pathol., 84, 35-39.
- Arabi MIE, Jawhar M, Al-Safadi B, Mirali N. 2004. Yield responses of barley to leaf stripe (Pyrenophora graminea) under experimental conditions in Southern Syria. J. Phytopathol., 152, 519-523.
- Delgado-Baquerizo M, Guerra CA, Cano-Diaz C. et al. 2020. The proportion of soil-borne pathogens increases with warming at the global scale. Nat. Clim. Chang., 10, 550-554.
- Delogu G, Porta-Puglia A, Vannacci G. 1989. Resistance of winter barley varieties subjected to natural inoculum of Pyrenophora graminea. J. Genet. Breed., 43, 61-65.
- Derveaux S, Vandesompele J, Hellemans J. 2010. How to do successful gene expression analysis using real-time PCR. Methods, 50, 227-230.
- Goko ML, Murimwa JC, Gasura E, Rugare JT, Ngadze E. 2021. Identification and characterization of seed-borne fungal pathogens associated with maize (Zea mays L.). Int J Microbiol. 6702856.
- Fetch TC, Steffenson BJ. 1999. Rating scales for assessing infection responses of barley infected with Cochliobolus sativus. Plant Dis., 83, 231217.
- Fernandez, MR, Holzgang G, Turkington, TK. 2009. Common root rot and crown rot of barley crops across Saskatchewan and in north-central Alberta. Can. J. Plant Pathol., 31, 96-102.
- Jawhar M, Shoiab A, Arabi MIE, Al-Daoude A. 2017. Changes in transcript and protein expression levels in the barley - Cochliobolus sativus interaction. Cereal Res. Comm., 45, 104-113.
- Ghazvini H. 2012. Adult plant resistance and yield loss in barley cultivars inoculated with a newly emerged pathotype of Bipolaris sorokiniana in Manitoba, Canada. Crop Breed. J., 2, 9 -15.
- Ghannam A, Alek H, Doumani S, Mansour D, Arabi MIE. 2016. Deciphering the transcriptional regulation and spatiotemporal distribution of immunity response in barley to Pyrenophora graminea fungal invasion. BMC Genom., 17, 256.
- Hammouda AM. 1986. Modified technique for inoculation in leaf stripe of barley. Acta Phytopathol. Entomol. Hung., 21, 255-259.
- Heydari nezhad A, Babaeizad V, Rahimian H. 2016. Studying PR2 and PAL genes involvement in rice resistance against Acidovorax avenae subsp. avenae. J. Agri. Biotech., 7, 67-81.
- Hyun MW, Yun YH, Kim JY, Kim SH. 2011. Fungal and Plant Phenylalanine Ammonia-lyase. Mycobiology., 39, 257-265.
- Kumar J, Schafer P, Huckelhoven R, Langen G, Baltruschat H, Stein E, Nagarajan S, Kogel HK. 2002. Bipolaris sorokiniana, a cereal pathogen of global concern: cytological and molecular approaches towards better control. Mol. Plant Pathol., 3, 185-195.
- Lakkis S, Trotel-Aziz P, Rabenoelina F, Schwarzenberg A, Nguema- Ona E, Clément C, Aziz A. 2019. Strengthening grapevine resistance by Pseudomonas fluorescens PTA-CT2 relies on distinct defense pathways in susceptible and partially resistant genotypes to downy mildew and gray mold diseases. Plant Sci. Front., 01112.
- Akiyama T, Jin S, Yoshida M, Hoshino T, Opassiri R, Leubner-Metzger G, Meins FJ. 1999. Functions and regulation of plant ß-1,3-glucanases (PR-2), in Pathogenesis-Related Proteins in Plants, eds Datta S, Muthukrishnan S. (Florida, FL: CRC Press LLC Boca Raton; ), 49-76.
- Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods. 25, 402-408.
- Pecchioni N, Vale G, Toubia-Rahme H, Faccioli P, Terzi V, Delogu G. 1999. Barley -Pyrenophora graminea interaction: QTL analysis and gene mapping. Plant Breed., 118, 29-35.
- Porta-Puglia A, Delogu G, Vannacci G. 1986. Pyrenophora graminea on winter barley seed: Effect on disease incidence and yield losses. J. Phytopathol., 117, 26-33.
- Raju S, Jayalakshmi SK, Sreeramulu K. 2008. Comparative study on the induction of defense related enzymes in two different cultivars of chickpea (Cicer arietinum L) genotypes by salicylic acid, spermine and Fusarium oxysporum f. sp Ciceri. Aust. J. Crop Sci., 2, 121-140.
- Vogt T. 2010. Phenylpropanoid biosynthesis. Mol. Plant., 3, 2-20.
- Zhang C, Wang X, Zhang F. et al. 2017. Phenylalanine ammonia-lyase 2.1 contributes to the soybean response towards Phytophthora sojae infection. Sci. Rep., 7, 7242.