Effect of infection of potato plants by Phytophthora infestans on pathway signaling of tub and PR5 genes
Journal: Journal of Stress Physiology and Biochemistry @jspb
Article in issue: 2 т.20, 2024.
Free access
Late blight, caused by the pathogen Phytophthora infestans is an economical disease of potato worldwide. To better understand mechanisms of potato to resist this fungus, pathway signaling of TUB and PR5 were monitored using quantitative real-time PCR (qPCR) across four time points post infection. Results demonstrated that significant variance in the expression profiles of both genes in infected potato plants as compared to the non-infected controls. It is also notable that TUB and PR5 genes have a higher and faster expression in the resistant cultivar ‘Spunta’ as compared to the susceptible one ‘Draga’ with a maximum expression for TUB (1.8 and 1.4-fold) and PR5 (3.5 and 1.2-fold) respectively, at 48 hours post infection. Our data suggest that TUB and PR5 genes, positively regulate P. infestans -resistance in potato plants during disease progress, which can provide testable hypotheses that will need direct future experiments to define how these pathway signaling of both genes may be specified in potato defense system.
Short address: https://sciup.org/143182786
IDS: 143182786
Text of the scientific article Effect of infection of potato plants by Phytophthora infestans on pathway signaling of tub and PR5 genes
Late blight (LB), caused by the fungus Phytophthora infestans Mont.) de Bary is an economically important disease of potato ( Solanum tuberosum L. ) that causes substantial crop losses worldwide (Xue et al., 2021; Dong and Zhou 2022). The pathogen has now spread widely and hence LB resistance breeding is an ongoing program across the world (Angmo et al. 2023). Furthermore, it is highly challenging to control LB due to a poor understanding of the resistance mechanisms and as a consequent, no highly resistant potato cultivar is yet available. Resistance to this disease often depends on the activation of defense responses that are regulated through different plant signaling pathways genes (Paluchowska et al., 2022). However, many of their specific functions still remain unknown.
Potato plants respond to P. infestans by activating various defense responses that are regulated through different signalling pathways. Pathogenesis-related (PR) proteins were discovered to primarily accumulate in plants in response to a variety of fungal diseases (Van Loon and Van Strien 1999). They are currently separated into 17 distinct classes (Van Loon et al., 2006), however, the Tubulin ( TUB ) and PR5 genes in potato plants have not been clearly demonstrated.
TUB genes were commonly used as reference genes for reverse-transcribed polymerase chain reaction (RT-PCR) since they have highly conserved in structure and function tubulin families (Jayaswal et al., 2019). However, characterization of host plant tubulin is equally vital along with tubulin from plant fungal pathogens since there is obvious indication, that microtubules and tubulins of the host plant cytoskeleton are rearranged in infected cells with these pathogens (Kitaeva et al., 2022). TUB expression has been observed in different plant species such as in cotton (Chen et al., 2021), potato (Koo et al., 2009; Al-Daoude et al., 2023) and in flax (Gavazzi et al., 2017). Furthermore, there is also evidence for increasing tubulin gene expression after infection with a mycorrhizal fungus (Plágaro et al., 2021).
On the other hand, thaumatin-like proteins (PR5) has an important function in plant disease resistance and its antifungal activity has been recorded in various plant species. It is well known that PR5 family includes basic and acidic members according to their isoelectric points, although they show similar activity, however, PR5 proteins had an antifungal activities that were observed in rice and orange plants after infection with to Rhizoctonia solani and Phytophthora infestans Bachmann et al., 1998). However, TUB roles, especially their interactions with the other defense responses in plant cells, are still not fully understood. Quantitative PCR (qPCR) is an effective method for measuring of the relative expression level of a particular genes and determines their expressions after infection by fungal pathogens (Derveaux et al., 2010).
Here, we monitored the defense reactions of two potato cultivars Spunta and Draga, which are included in international breeding programs targeted at developing P. infestans, resistant potato cultivars. Spunta was defined as resistant i.e. showed a lower level (compared with Draga) of LB symptom development (Salima 2015). We thus hypothesized that TUB and PR5 genes could drive contrasted resistance levels in Spunta and Draga, inoculated by the same isolate of P. infestans . Thus, the current work aimed at evaluating the expressions of these both genes in two potato cultivars with varying levels of resistance against P. infestans fungus using PCR (qPCR) method.
MATERIALS AND METHODS
Host Plant
The two potato resistant (cv. Spunta) and susceptible (cv. Draga) cultivars from Netherlands grown commonly in Syria were used in this work (Salima 2015). A single seed tuber (~ 65 g) was planted at the center of each plastic pot filled with sterilized peatmoss with five replicates. Pots were placed in a growth chamber set at 20° (16h light/ 8h dark) and 85-90 % relative humidity.
Infection with P. infestans
The Syrian virulent isolate PiSYR1 (Salima 2015) was used in the experiments. It was isolated from small infected potato leaves and placed in Petri dishes under disinfected tuber slices and incubated in a growing chamber for 7 days at 20 °C and 16 h/8h (light/dark). When mycelium was growing on the surface of the potato slice, the mycelium was transferred to fresh rye agar (Caten and Jinks 1968). The conidial suspension was adjusted to 5 × 104 spores/mL and sprayed with a handheld sprayer onto the potato seedlings. The control plants were sprayed with fungus-free water.
RNA isolation and cDNA synthesis
RNA was isolated from Potato primary leaves of infected and no-infected leaves after 24, 48, 72 and 96 hours post infection (hpi) using Trizol Reagent (Macherey-Nagel, Germany) based on the manufacturer’s guidelines. The control samples were collected at the similar time periods. cDNA was created using the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions.
Quantitative RT-PCR analysis
TUB and PR5 genes were assayed at each time point with RT-qPCR assays using SYBR Green Master kit (Roche, USA). The used primers used are presented in Table 1. The PCR conditions were 95° for 5 min, followed by 40 cycles of 95° for 10 s, 60° for 20 s, and 72° for 20 s. Gene expression was calculated by the 2-ΔΔCt method using EF1α as a reference gene (Livak and Schmittgen 2001). Means were compared using Tukey’s test. All experiments were repeated in triplicate.
RESULTS AND DISCUSSION
In this study, two potato cultivars with varying resistance levels against the fungus P. infestans were used. The pathogen caused more severe symptoms on the susceptible cv. ‘Draga’ as compared to the resistant one ‘Spunta’. P. infestans produced blackish-brown lesions on leaves and stems and developed latter to water-soaked or have chlorotic borders and the entire leaf becomes become necrotic, and these symptoms were more severe on the susceptible cv. ‘Draga’ after 10 days of infection (Table 2).
To better understand these interactions, TUB and PR5 expressions were monitored at four early time points of potato infection by P. infestans. Data showed that at 24 hpi, the both genes were significantly upregulated after P. infestans infection in resistant and susceptible cultivars (Figs. 1 and 2), suggesting that robust and distinct defense responses are early initiated. However, the expressed gene patterns of both resistant and susceptible potato plants were recorded cooperative functions which occur after 24, 48, 72 and 96 hours attacking by P. infestans. For instance, the results revealed that maximum gene expressions in resistant and susceptible were 48 hours post inoculation for TUB (1.8 and 1.4-fold) and PR5 (3.5 and 1.2-fold), respectively (Figs. 1 and 2).
However, considering that the two used potato cultivars had high different levels of resistance to P. infestans (Salima 2015; Al-Daoude et al., 2023). The TUB and PR5 were up-regulated 24 hpi in inoculated potato plants as compared to non - inoculated plants, which might indicate that their roles are related to the severity of LB symptoms rather than to resistance. These upregulations were higher in the resistant cultivar than in the susceptible cultivar (Figs. 1 and 2).
Our findings are in line with Van Loon et al. (2006) who reported that some PR proteins might have important functions against oomycetes fungi such as P. infestans . On the other hand, PR 5 was increased in both potato cultivars during the time of infection up 96h (Fig. 2). It is well known that PR5 exert their antifungal activity through a very fast and dramatic increase in the permeability of the pathogen's plasma membrane, by disrupting the lipid bi-layer and creating trans-membrane pores (Vigers et al., 1992; Krebitz), this incident might explain its roles in potato cell during infection with P. infestans.
On the other hand, increased potato TUB expression at 48 and 72 hpi could be due to plant cytoskeleton rearrangement in response to biotrophic infection, and the subsequent decrease in TUB expression at 96 hpi could be due to plant cell disruption resulting from tissue damage during necrosis. Gasic et al. (2019) found differential expressions of tubulins due to a result of a post-transcriptional regulation of tubulin mRNA. Our results are in same with those of Kobayashi et al. (1994) who observed new arrangements of TUB in flax cells after flax rust infection.
Table 1 : List of genes studied with accession number and corresponding primers used for RT-qPCR
|
Gene |
Accession No. Sequence TGGATTTGAGGGTGACAACA |
|
EF1α |
AT1G07920 CCGTTCCAATACCACCAATC GGGGCTACTGTTTCAAGCAA |
|
PR5 |
AT1G75040 GCAGACTGTGGCGGTCTAAG GCGTTGAGGTCAGAGACACA |
|
TUB |
NM_001288449 ATGTTGCTCTCGGCTTCAGT |
Table 2 : Late blight symptoms on two potato cultivars used in this study
Cultivar Disease* symptoms
Spunta R Small blackish-brown lesions on leaves and stems
Draga S Water-soaked or have chlorotic borders and the entire leaf becomes necrotic
*Disease reaction as described by Salima (2015), where; R: resistant and S: susceptible
Figure 1. Relative expression profiles of TUB and PR5 genes in the resistant cv. Spunta during the time course following infections with late blight disease. Error bars are representative of the standard error (Mean ± SD, n = 3). Data are normalized to Elongation factor 1α (EF-1α) gene expression level (to the calibrator, Control 0 h, taken as 0).
Figure 2. Relative expression profiles of TUB and PR5 genes in the susceptible cv. Draga during the time course following infections with late blight disease. Error bars are representative of the standard error (Mean ± SD, n = 3). Data are normalized to Elongation factor 1α (EF-1α) gene expression level (to the calibrator, Control 0 h, taken as 0).
CONCLUSION
In this investigation, our data showed that significant increases in TUB and PR5 expressions were found upon potato challenged with the P. infestans which can contribute to LB resistance, since these signaling responses induced together in each cultivar. It is also noteworthy that both genes have higher and faster expressions in the resistant cultivar as compared to the susceptible one with a maximum for TUB (1.8 and 1.4-fold) and PR5 (3.5 and 1.2-fold) respectively, at 48 hours post inoculation . These findings could be in agreement with the well-accepted notion that defense responses are very intense in potato resistant plants. In addition, we highlighted the fact that the two different signaling pathways may be induced in response to the same isolate of P. infestans in different potato cultivars.
ACKNOWLEDGEMENTS
The authors thank the Director General of AECS and the Head of Biotechnology Department for their help throughout the period of this research.
CONFLICTS OF INTEREST
The authors declare that they have no potential conflicts of interest.
References Effect of infection of potato plants by Phytophthora infestans on pathway signaling of tub and PR5 genes
- Al-Daoude A, Shoiab A, Jawhar M. (2023). Increased expression of beta-tubulin in potato plants challenged with Phytophthora infestans. J. Stress Physiol. Biochem., 19: 105-110.
- Angmo D, Sharma SP, Kalia A. (2023). Breeding strategies for late blight resistance in potato crop: recent developments. Mol Biol Rep., 50: 78797891.
- Bachmann D, Rezzonico E, Retelska D, Chetelat A, Schaerer S, Beffa R. (1998). Improvement of potato resistance to Phytophtora infestans by overexpressing antifungal hydrolases. 5th International Workshop on pathogenesis-related proteins. Signaling pathways and biological activities. 1998, Aussois, France. Abstr. P-57. American Society of Plant Physiologists.
- Caten CE, Jinks JL. (1968). Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot., 46: 329-347.
- Chen B, Zhao J, Fu G. et al. (2021). Identification and expression analysis of Tubulin gene family in upland cotton. J. Cotton Res., 4: 20
- Derveaux S, Vandesompele J, Hellemans J. (2010). How to do successful gene expression analysis using real-time PCR. Methods, 50: 227-230.
- Dong S, Zhou S, (2022). Potato late blight caused by Phytophthora infestans: From molecular interactions to integrated management strategies, J Integr Agric, 21: 3456-3466,
- Jayaswal PK, Shanker A, Singh NK. (2019). Phylogeny of actin and tubulin gene homologs in diverse eukaryotic species. Indian J. Genet., 79: 284- 91.
- Gasic I, Boswell SA, Mitchison TJ. (2019). Tubulin mRNA stability is sensitive to change in microtubule dynamics caused by multiple physiological and toxic cues. PLoS Biol., 9: 17.
- Gavazzi F, Pigna G, Braglia L, et al. (2017). Evolutionary characterization and transcript profiling of ß- tubulin genes in flax (Linum usitatissimum L.) during plant development. BMC Plant Biol., 17:237.
- Kitaeva AB, Gorshkov AP, Kusakin PG, Sadovskaya AR, Tsyganova AV, Tsyganov VE. (2022). Tubulin cytoskeleton organization in cells of determinate nodules. Front. Plant Sci., 26:13: 823183.
- Kobayashi I, Kobayashi Y, Hardham AR. (1994). Dynamic reorganization of microtubules and microfilaments in flax cells during the resistance response to flax rust infection. Planta, 195: 23747.
- Koo BS, Kalme S, Yeo SH, Lee SJ, Yoon MY. (2009). Molecular cloning and biochemical characterization of alpha- and beta-tubulin from potato plants (Solanum tuberosum L.). Plant Physiol. Biochem., 47: 761-8.
- Krebitz M, Wagner B, Ferreira F, Peterbauer C, Campillo N, et al., (2003). Plant-based heterologous expression of Mal d 2, a thaumatin-like protein and allergen of apple (Malus domestica), and its characterization as an antifungal protein. J Mol Biol., 329: 721-730.
- Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) method. Methods, 25: 402-408.
- Paluchowska P, Sliwka J. Yin Z. (2022). Late blight resistance genes in potato breeding. Planta, 255: 127.
- Plágaro TH, Huertas R, María I Navarrete T, Blancaflor E, Gavara N, García-Garrido JM. (2021). A novel putative microtubule-associated protein is involved in arbuscule development during arbuscular mycorrhiza formation, Plant and Cell Physiol., 62: 306-320
- Salima NI. (2015). Surveying the distribution of late blight Phytophthora infestans on potato in Syria and Studying the physiological and molecular variability of the pathogen. Thesis, University of Damascus, Faculty of Agriculture, pp.61.
- Van Loon LC, van Strien EA. (1999). The families of pathogenesis related protein, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol., 55: 85-97
- Van Loon LC, Rep M, Pieterse CM. (2006). Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol., 44: 135-162.
- Vigers AJ, Wiedemann S, Roberts WK, Legrand M, Selitrennikoff CP, et al., (1992). Thaumatin-like pathogenesis-related proteins are antifungal. Plant Sci., 83: 155-161.
- Xue X, Geng T, Liu H, Yang W, Zhong W, Zhang Z, Zhu C, Chu Z. (2021). Foliar application of silicon enhances resistance against Phytophthora infestans through the ET/JA- and NPR1- dependent signaling pathways in potato. Front. Plant Sci., 12: 609870