Increased expression of beta-tubulin in potato plants challenged with phytophthora infestans
Journal: Journal of Stress Physiology and Biochemistry @jspb
Article in issue: 1 т.19, 2023.
Free access
Late blight, caused by Phytophthora infestans is an important foliar disease of potato worldwide. Relatively little is known about the mechanisms of interaction between potato and this fungal pathogen. In the present work, expression of beta-tubulin (TUB) gene was monitored in resistant and susceptible potato cultivars at four early points of infection using quantitative real-time PCR (qPCR). Data showed significant variation in the expression patterns of the TUB gene during potato- P. infestans interactions as compared to the non-inoculated controls. It also shows that β- tubulin gene has a higher expression and faster induction in the resistant cultivar (0.9-fold) as compared with the susceptible one (0.11-fold), 24 hours post inoculation (hpi). However, the maximum expressions were 1.85 -folds in the resistant, and 1.3 -folds in the susceptible one 48 and 72 hpi, respectively. Increased potato TUB expression could be due to plant cytoskeleton rearrangement in response to P. infestans up to 72 hpi, and the subsequent decrease in its expression at 96hpi could be due to plant cell disruption resulting from tissue damage during necrosis. The information obtained from this study highlights crucial remarks into the signaling pathway that accounts for TUB gene expression changes elicited during potato- P. infestans interactions, which can provide testable hypotheses that will need direct future tests to determine how TUB changes may be specified in the defense system.
Short address: https://sciup.org/143179369
IDS: 143179369
Text of the scientific article Increased expression of beta-tubulin in potato plants challenged with phytophthora infestans
The fungus Phytophthora infestans (Mont.) de Bary , is the causal agent of late blight disease of potato ( Solanum tuberosum L. ), that attack both potato foliage and tubers causing substantial crop losses (Kamoun et al., 2015; Xue et al., 2021). During infection, the pathogen shows an initial asymptomatic biotrophic stage of infection followed by a necrotrophic stage which is characterized by hyphal ramification, water soaking and necrosis (Grenville Briggs et al ., 2005). However, resistance of potato plants to this disease often depends on the activation of defense responses that are regulated through different plant signaling pathways genes (Gao and Bradeen 2016; Paluchowska et al., 2022). However, many of their specific functions still remain unknown.
Tubulin genes which are highly conserved in structure and function from alpha, beta, and gamma tubulin families were commonly used as reference genes for reverse transcribed polymerase chain reaction (RT PCR) (Ray and Johnson 2014; Jayaswal et al., 2019). However, the expression pattern of plant tubulin has been studied in various species such as in populous (Oakley et al., 2007), in potato (Koo et al., 2009), in flax (Gavazzi et al., 2017) and in cotton (Chen et al., 2021). There is growing evidence, based primarily on microscopy studies, that microtubules and tubulins of the host cytoskeleton are rearranged in infected cells with fungal pathogens (Skalamera and Heath 1998; Kitaeva et al., 2022). There is also evidence for increased expression of host tubulin gene during infection with a mycorrhizal fungus (Plágaro et al., 2021). However, characterization of host plant tubulin is equally important along with tubulin from plant pathogenic fungi.
β tubulin gene (TUB) has been characterized in potato plants and cloned full length cDNAs isolated from potato leaves using RT PCR revealed that potato plants beta tubulin were predicted to encode 451 amino acid long proteins with molecular masses of 60 kDa (Taylor et al., 1994; Koo et al., 2009). Different works showed that the expression of at least one tubulin gene can be altered due to certain external stimuli (Gasic 2022), and perhaps fungal infection could also affect TUB expression. However, it is unknown whether potato plant TUB gene expression could also be altered by P. infestans infection. Thus, the present work aimed at evaluating the changes in induction of in a TUB expression in two potato cultivars with different levels of resistance towards P. infestans pathogen using PCR (qPCR) approach.
MATERIALS AND METHODS
Plant material
The two Netherlands potato resistant (cv. Sponta) and susceptible (cv. Draga) cultivars (Salima 2015) grown widely in Syria were used in this work. A single seed tuber (~ 60 g) was planted at the center of plastic pots filled with sterilized peatmoss with five replicates. Pots were placed in a growth chamber set at 20° with a 16 h (light) and 8h (dark) cycle and 90 % relative humidity.
Inoculation with P. infestans
The virulent P. infestans isolate PiSYR1 (Salima 2015) was used in this work. Small pieces of infected potato leaves were placed in Petri dishes under disinfected tuber slices and incubated at 20 °C and 16 h/8h (light/dark) for 7 days. Mycelium was transferred to fresh rye agar after growing on the surface of the potato slice (Caten and Jinks 1968). Inoculation was performed by conidial suspension adjusted to 5 × 104 spores/mL sprayed with a hand sprayer onto the potato seedlings in each pot. The plants sprayed with pathogen free water served as controls.
RNA manipulations
Total RNA was isolated from potato leaves of infected and non infected leaves 24, 48, 72 and 96 hpi using Trizol Reagent (Macherey Nagel, Germany). The control plants were collected at the same time points. cDNA was synthesized with the QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s instructions.
Quantitative RT-PCR analysis
TUB gene expression were analyzed at the four selected times with RT qPCR assays using SYBR Green Master kit (Roche, USA). The primers sequences used are presented in Table 1. The PCR conditions were 95° for 5 min, followed by 40 cycles of 95° for 10 s, 60° for 20 s, and 72° for 20 s. The TUB expression level was calculated according to Livak and Schmittgen (2001) method using EF1α as an internal reference. Standard deviation was calculated from the replicated experimental data. The treated means were compared using Tukey’s test at the significance 0.05 level. All the experiments were repeated at least twice in triplicate.
RESULTS AND DISCUSSION
In this investigation, four time points 24, 48, 72 and 96 h of P. infestans infection, were chosen as being representative of biotrophy and transition to necrotrophy phases. The choice of these time points was based on the stages in the infection cycle, as 24h to 48h the biotrophic stage, and 72h beginning the necrotrophic stage as shown in Table 2 (Xiao et al. 2019).
Further studies of potato interactions with P. infestans by measuring TUB gene expression at four early time points after pathogen challenge, the data demonstrated that at 24 hpi, the TUB expression were significantly upregulated after P. infestans inoculation in both resistant and susceptible cultivars (Fig. 1), suggesting that robust and distinct defense responses are initiated early. It is also noteworthy that TUB gene has a higher expression and faster induction in the resistant cultivar (0.9 fold) as compared with the susceptible one (0.11 fold), at 24 hours post inoculation (hpi). However, the maximum expressions were 1.85 – folds in the resistant, and 1.3 –folds in susceptible one after 48 and 72 hpi, respectively (Fig. 1).
This increase in TUB expression corresponded to the conversion from the biotrophic to necrotrophic stage of infection in potato leaves which was observed between 48 and 72 hpi. By 96 hpi, the pathogen appears to have heavily colonized the plant tissue. Increased potato TUB expression at 48 and 72 hpi could be due to plant cytoskeleton rearrangement in response to biotrophic infection, and the subsequent decrease in TUB expression at 96 hpi could be due to plant cell disruption resulting from tissue damage during necrosis. Yen et al. (1988) and Gasic et al. (2019) reported that the differential expressions of tubulins due to a result of a post transcriptional regulation of tubulin mRNA. This mechanism, known as tubulin autoregulation, is a negative feedback loop that involves indirect cotranslational regulation of the stability of mature spliced, but not unspliced, tubulin pre mRNA by unpolymerized tubulin.
Our results are in good agreements with those of Kobayashi et al. (1994) who found new arrangements of TUB have been observed in flax cells responding to the flax rust infection, and with Swiecicka et al . (2009) increase in the expression of tubulin and microtubule associated proteins during nematode infection. Also, on line with Haikonen et al. (2013), who stated involvement of microtubule protein in infection of plants with a potyvirus, Potato virus A (PVA).
Table 1 . Properties and nucleotide sequences of primers used in this study
|
Gene |
Gene description |
Accession No. |
Sequence |
Amplified fragment (bp) |
|
EF1α |
Elongation factor 1 Alpha |
AT1G07920 |
5' TGTTGTCACCCTCAAATCCA 3' 5' GATTGGTGGTATTGGAACGG 3' |
153 |
|
TUB |
beta tubulin protien |
NM_00128844 9 |
5' TCTGCAACCATGAGTGGTGT 3' 5' ATGTTGCTCTCGGCTTCAGT 3' |
150 |
Table 2 . Sampling time points according to the developmental stages of P. infestans
Hours after inoculation (hpi) 24hpi 48hpi 72hpi 96hpi
Sampling time point
Germination of conidia and beginning the biotrophic phase
The biotrophic phase, germinating sporangia
Invading hyphae penetrating plant tissue
Hyphal growth and apparent of mycelial branching
Water soaking (gray green) visible, indicating the transition from biotrophy to necrotrophy The developmental stages of the fungus as described Xiao et al. (2019).
Time (Hours)
Figure 1 . Relative expression profiles of TUB gene in the resistant cv. Spunta (A) and in the susceptible cv. Draga (B) during the time course following infections with late blight disease. Error bars are representative of the standard error (Mean ± SD, n = 3). Data are normalized to Elongation factor 1α (EF 1α) gene expression level
(to the calibrator, Control 0 h, taken as 0)
CONCLUSION
In this work, TUB gene showed different patterns of expression with an initial increase following potato infection with P. infestans in both resistant and susceptible cultivars indicating that this gene is activated directly after the pathogen attack. It is noteworthy that TUB has higher expression and faster induction in the resistant cultivar as compared with the susceptible one. However, increased TUB expression could be due to plant cytoskeleton rearrangement in response to biotrophic infection, and the subsequent decrease in its expression could be due to plant cell disruption resulting from tissue damage during necrosis. The data can provide testable hypotheses that will need further tests to determine how TUB changes may be specified in the defense system.
ACKNOWLEDGMENT
The authors thank the Director General of AECS and the Head of Molecular biology and Biotechnology Department for their support this research.
CONFLICTS OF INTEREST
The authors declare that they have no potential conflicts of interest.
References Increased expression of beta-tubulin in potato plants challenged with phytophthora infestans
- Boava LP, Cristofani-Yaly M, Stuart RM, Machado MA. 2011. Expression of defense-related genes in response to mechanical wounding and Phytophthora parasiticainfection in Poncirus trifoliata and Citrussunki. Physiol. Mol. Plant Pathol., 77: 1-7.
- Caten CE, Jinks JL. 1968. Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation. Can. J. Bot., 46: 329-347.
- Chen B, Zhao J, Fu G. et al. 2021. Identification and expression analysis of Tubulin gene family in upland cotton. J. Cotton Res., 4: 20.
- Jayaswal PK, Shanker A, Singh NK. 2019. Phylogeny of actin and tubulin gene homologs in diverse eukaryotic species. Indian J. Genet., 79: 28491.
- Haikonen T, Rajamaki ML, Valkonen JPT. 2013 Interaction of the microtubule-associated host protein HIP2 with viral helper component proteinase is important in infection with potato virus A. MPMI., 26: 734-744.
- Gao L, Bradeen JM. 2016. Contrasting potato foliage and tuber defense mechanisms against the late blight pathogen Phytophthora infestans. PLoS One, 21: 11.
- Grenville-Briggs LJ, Avrova AO, Bruce CR, Williams A, Whisson SC, Birch PR, van West P. 2005. Elevated amino acid biosynthesis in Phytophthora infestans during appressorium formation and potato infection. Fungal Genet. Biol., 42: 244-256.
- Gasic I, Boswell SA, Mitchison TJ. 2019. Tubulin mRNA stability is sensitive to change in microtubule dynamics caused by multiple physiological and toxic cues. PLoS Biol., 9: 17.
- Gasic I. 2022. Regulation of tubulin gene expression: From isotype identity to functional specialization. Front. Cell Dev. Biol., 10: 898076.
- Gavazzi F, Pigna G, Braglia L, et al. 2017. Evolutionary characterization and transcript profiling of p-tubulin genes in flax (Linum usitatissimum L.) during plant development. BMC Plant Biol., 17: 237.
- Kobayashi I, Kobayashi Y, Hardham AR. 1994. Dynamic reorganization of microtubules and microfilaments in flax cells during the resistance response to flax rust infection. Planta, 195: 23747
- Kitaeva AB, Gorshkov AP, Kusakin PG, Sadovskaya AR, Tsyganova AV, Tsyganov VE. 2022. Tubulin cytoskeleton organization in cells of determinate nodules. Front. Plant Sci., 26: 13: 823183.
- Koo BS, Kalme S, Yeo SH, Lee SJ, Yoon MY. 2009. Molecular cloning and biochemical characterization of alpha- and beta-tubulin from potato plants (Solanum tuberosum L.). Plant Physiol. Biochem., 47: 761-8.
- Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods, 25: 402-408.
- Oakley RV, Wang YS, Ramakrishna W, Harding SA, Tsai CJ. 2007. Differential expansion and expression of alpha- and beta-tubulin gene families in Populus. Plant Physiol., 145: 961-73.
- Paluchowska P, Sliwka J. Yin Z. 2022. Late blight resistance genes in potato breeding. Planta, 255: 127.
- Plágaro TH, Huertas R, María I Navarrete T, Blancaflor E, Gavara N, García-Garrido JM. 2021. A novel putative microtubule-associated protein is involved in arbuscule development during arbuscular mycorrhiza formation, Plant and Cell Physiology, 62: 306-320.
- Ray DL, Johnson JC. 2014. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR. BMC Res. Notes., 7: 304.
- Skalamera D, Heath MC. 1998. Changes in the cytoskeleton accompanying infection-induced nuclear movements and the hypersensitive response in plant cells invaded by rust fungi. The plant J., 16: 191-200.
- Xiao C, Gao J, Zhang Y, Wang Z, Zhang D, Chen Q, Ye X, Xu Y, Yang G, Yan L, Cheng Q, Chen J, Shen Y. 2019. Quantitative proteomics of potato leaves infected with Phytophthora infestans provides insights into coordinated and altered protein expression during early and late disease stages. Int. J. Mol. Sci., 20: 136.
- Xue X, Geng T, Liu H, Yang W, Zhong W, Zhang Z, Zhu C, Chu Z. 2021. Foliar application of silicon enhances resistance against Phytophthora infestans through the ET/JA- and NPR1-dependent signaling pathways in potato. Front. Plant Sci., 12: 609870
- Salima NI. 2015. Surveying the distribution of late blight Phytophthora infestans on potato in Syria and Studying the physiological and molecular variability of the pathogen. Thesis, University of Damascus, Faculty of Agriculture, pp.61.
- Swiecicka M, Filipecki M, Lont D, van Vliet J, Qin L, Govers A, Bakker J, Helder J. 2009. Dynamics in the tomato root transcriptome on infection with the potato cyst nematode Globodera rostochiensis. Mol. Plant Pathol., 10: 487- 500.
- Taylor MA, Wright F, Davies HV. 1994. Characterizations of the cDNA clones of two beta-tubulin genes and their expression in the potato plant (Solanum tuberosum L.). Plant Mol Biol., 26: 013-18.
- Yen TJ, Machlin PS, Cleveland DW. 1988. Autoregulated instability of beta-tubulin mRNAs by recognition of the nascent amino terminus of beta-tubulin. Nature, 334: 580-585.