Participation of MIR775A in post-transcriptional regulation glycerol-3-phosphatacyltransferases in corn leaves under hypoxia

Author: Fedorin D.N., Khomutova A.E., Eprintsev A.T.

Journal: Журнал стресс-физиологии и биохимии @jspb

Article in issue: 4 т.20, 2024.

Free access

Oxygen deficiency causes significant changes in plant metabolism related to the coordination of metabolic processes for stress adaptation. MicroRNAs provide regulation of target genes at the post-transcriptional level. The plant cell presents hypoxia-dependent microRNAs, including miR775A, whose quantity increases under these stress conditions. An electrophoretic study of total RNA samples from corn leaves under hypoxia has revealed the presence of two interfering complexes with miR775A at the 12th hour of the experiment. Sequencing and subsequent analysis of the nucleotide sequence of image 2 of the miR775A interfering complex with mRNA from corn leaves have showed a high degree of homology with the N-acyltransferase domain, and corresponded to a fragment of glycerol-3-phosphate acyltransferase mRNA. Inhibition of glycerol-3-phosphate acyltransferase in maize leaf cells under hypoxia can probably provide regulation of cellular fatty acid metabolism under the influence of a stress factor.

Microrna mir775a, glycerol-3-phosphate acyltransferase, hypoxia, rna interference

Short address: https://sciup.org/143183428

IDR: 143183428

Text of the scientific article Participation of MIR775A in post-transcriptional regulation glycerol-3-phosphatacyltransferases in corn leaves under hypoxia

Plants adapt to various environmental stresses through the regulation of a number of genes (Seki et al. , 2002, Zhu, 2002). Recent studies have shown that plant microRNAs and siRNAs participate in biotic and abiotic stress responses (Ruiz-Ferrer, Voinnet, 2009). Anaerobic or low-oxygen stress (hypoxia) causes changes in the transcriptome and a switch from aerobic respiration to anaerobic metabolism (Agarwal, Grover, 2006). It has been shown that during immersion of Arabidopsis seedlings in water, Zm-miR166, Zm-miR167, Zm-miR171, Os-miR396 and Zm-miR399 have been induced, but Zm-miR159, At-miR395, Pt-miR474 and Os-miR528 have been reduced (Zhang et al. , 2008). Nineteen hypoxia-dependent miRNA families have also been identified, the number of which is inversely correlated with the number of their specific target mRNAs. Levels of gene expression miR156g, miR157d, miR158a, miR159a, miR172a,b, miR391 and miR775 have been increased by hypoxia exposure (Khraiwesh et al. , 2012).

Inhibition of mitochondrial respiration pathways under hypoxia results in induction of miRNA775a, indicates its important role in the regulation of this process (Moldovan et al. , 2009). In oxygen-deficient conditions, fatty acids (FAs) play an important role. Obtained either through exogenous uptake or de novo synthesis, FAs are used as substrates for oxidation and energy production, membrane synthesis, energy storage in the form of triacylglycerols (TAGs) and production of signalling molecules (Khraiwesh et al. , 2012). Since the expression levels of a number of microRNAs including miR775 increased under hypoxia conditions (Moldovan et al. , 2009), the study of its role in post-transcriptional regulation of target genes of cell lipid metabolism is relevant.

MATERIAL AND METHODS

The action of low oxygen concentrations on plants was carried out by placing the plants with for 24 h in water. Plants under normal aeration conditions were used as a control group. To exclude the influence of the photosynthetic system, both groups of plants were preexposed in the dark for 24 h before the experiment.

RESULTS AND DISCUSSION

To identify targets of RNA interference involving miR775A, total cellular RNA have been isolated from maize leaves at different hours of hypoxia. Total RNA have been reverse transcribed and the resulting cDNA have been incubated with the specific fluorescent probe miR775AROX. Electrophoretic mobility shift assay of cDNA samples after incubation with the probe has showed the presence of hybridisation products, indicating the formation of interfering complexes with miR775A. It has been shown that up to 6 hours of exposure time, one target is detected for miR775A, but after 12 hours of exposure time, there are two targets (Fig.1). The results of hybridisation analysis indicate a change in the number and type of targets for miR775A in maize leaves during the development of hypoxic stress, as the fluorescent complexes with the miR775A-ROX probe have different sizes, as determined using DNA length markers.

Nucleotide sequence analysis of sample 2 of the miR775A interfering complex with mRNA from maize leaves has showed a high degree of homology with the N-acyltransferase domain of various enzymes that catalyse the transfer of the acyl group to the substrate (Fig.2).

Using a bioinformatics approach based on RPS-BLAST, a comparative analysis for domain element matching of annotated proteins based on the NAT_SF acyltransferase domain architecture has been performed (Jiyao et al. , 2023). In the analysed sequence, the characteristic elements of this domain have been identified, forming the corresponding active centre of the enzyme, as well as the appropriate surrounding by amino acid residues, ensuring its correct orientation in the protein globule.

The highest affinity of the resulting sequences have been shown with glycerol-3-phosphate acyltransferase mRNA (LOC100285746) (Fig 3). Members of this protein family include N-acetyltransferases (GNATs) such as aminoglycoside-N-acetyltransferases, histone N-acetyltransferase (HAT) enzymes and serotonin-N-acetyltransferases that catalyse the transfer of the acetyl group to the substrate, arginine/ornithine-N- succinyltransferase, myristoyl-CoA: Protein-N-myristoyltransferase, etc (Jiyao et al., 2023).

It has been shown that the attachment site of miR775A corresponds to the zone of the lyase domain, which confirms the possibility of forming an interfering complex with it (Fig. 4).

Also of note is the incomplete correspondence of miR775A with maize glycerol-3-phosphate acyltransferase mRNA. The 5'-end of miR775A shows the formation of a complementary element of 6 nucleotides (Fig. 4), confirming its participation in the formation of the interfering complex.

Glycerol-3-phosphate acyltransferase is involved in the metabolism of glycerophospholipids and phosphoglycerides, the alpha-glycerophosphate pathway (Shindou, Shimizu, 2009). Lipids are ubiquitously involved in the regulation of plant adaptive responses during hypoxia and post-hypoxic reoxygenation. In particular, polyunsaturation of long-chain acyl-CoA regulates hypoxia sensitivity in plants by modulating the dynamics of acyl-CoA-binding protein (Zhou et al., 2020). Lipids also mediate signal transduction in plant response to biotic and abiotic stresses (Lung, Chye, 2019, Wang, 2004). The production of lipid signalling molecules is strictly regulated by a set of specialised lipid-modifying enzymes and acyl-lipid metabolic networks (Noack, Jaillais, 2020). In particular, abiotic stresses such as chilling, freezing, heating, drought and hypoxia activate lipid-mediated signaling cascades, increasing plant tolerance to these stresses (Hou et al., 2016).

Long-chain acyl-CoAs act as central nodes of cellular metabolism and signal transduction, which are regulated by cis-CoA-binding protein in different compartments of plant cells (Xiao, Chye, 2011, Neess et al. , 2015). Two independent studies have shown that long-chain acyl-CoA may be signalling molecules that modulate membrane receptor association (Schmidt et al. , 2018, Zhou et al. , 2019). Schmidt et al. have showed that due to a hypoxia-induced decrease in cellular ATP levels, the activity of long-chain acyl-CoA synthetase is reduced, resulting in a shift in the composition of acyl-CoA pools (Schmidt et al. , 2018).

6       12hours hours

sample 1sample 2

unbound probe

  • Figure 1:    Electrophoretic study of the formation of fluorescent complexes of mRNA from maize leaves with the miR775A-ROX probe at different hours of hypoxic stress.

    ----fYEVCfLYIFd—q-----rtGIKLKRNFK------fni

94 sequence

106 Tetrahymena thermophila

130 Vibrio cholerae

519 Haloarcula marismortui

126 Rhodospirillum rubrum

117 Cytophaga hutchinsonii

180 Zea mays

—qrfAEVAfLAVTaneq---vrgyGTRLMNKFKDhmqk-qni

---dvTFLRdFQ ILpe fq gcgiGSKCLELWRha 1 d- rqs elhvyGNAVgVGQEgddedhqhkgyGKKLLEKAEVlard-agf

—nphHAVEIVRMIavrp---glgiGKAMMEAVIDhafsglga

-qgylLFIDeLYIVpdkr slgyGRTCITLIEKtfh di yhkal REPF DLYMFgqny-------GIRPL VLCKP fsm rg

  • Figure 2:    Comparative analysis of the amino acid sequences of annotated proteins with a NAT_SF acyltransferase domain and a fragment of the amino acid sequence based on the sequence of the RNA interfering complex with maize microRNA775A. The sequences indicate the amino acids (highlighted underlining) that form this domain and the binding site for coenzyme A (highlighted in yellow).

GPAT         agagcagtatcatgaagcctgctctcctgagactgattccataactaaccttgccaatca3660

ggq          ----------------------------------------------------GCCCAGCC8

ititit it

GPAT         gacaggcaatttattctgccaacaaagctgcagactgctgttcgaggaattgcagaatct3720

seq          GACAGTCAATTTATTTTAGTGAATAAGCTGCATACAGCTTTGAAAGTAAATACAGGATAG68

ititititit it it it it it k it it it        it it it it it k к it kk kkk к kk kk к ★★ kk

GPAT         tcttgcagtcaagaaggatcttgaaccagaatattcatgcagagttgttcaacgcatcca3780

seq          TGGTACAGTAACTACTGAGCTCGAACCTGAATATTCATGCAGAGTTGTTCAACGCATCCA128

  •    к kkkk    kk ★★ kkkkk к к к к к к к к к к к к к к к к к к к к к к к к к к к к к к к к

GPAT          tga aga tgt а с сада а да agt ccttg ctttgga caa a agagt tgagt gt a a c tccagg at384 0

seq          TGAAGATTTATAAATAGAATTATTTGTTTTTGACAAAAGAGTTGAGTGTAACTCCAGTAT 188

kkkkkkk kk kk ★★★★ к kkk it it it it it it it it it it it it it it it it it it it it it it it it it it it it it it it

GPAT         tgccgttgcactttcattaatggatgagtgcttccttccgattattgaccagagaactgg3900

seq          TGCTTGTGTAAGATCTTTTTATGAGGTTTGCTTGATTTAGATATTTGACCAGAGAACTGG248

  • ★    ★★         ★★ к it it itit          itir it it it it it it itit ititit it it it it it it it it it it it it it it it it

    GPAT         catcaacttgatacgaaatgttgtgtatagctgtggatcaaattttgcccggttggattt3960

seq          CAICAAATTGAAACGAAATTTTTGATTTTGAATTGAGTATTTTTTTGTTTGGTTAGATTT308

  • ★    ★★★★★   ★★★★   ★★★★★★★ ★★ it it it itit it       ititititit itiritit ititititit

    GPAT         ccgtggattctatatatttattttagaacgtggagatgaaataatagctgcagcatctgt4020

seq          CCGTGTAATCTATATTTTTTTTTTTGAATATGAAGATAAAATTGTATCTCCCGCCCCCGC368

ititititit it it it it it it it it ititit itititit itirir itit itititit itititit itit itit it itit it it

GPAT         ccgaatacatggaaccaagttagctgagatgccgttcattggtacccggaatatgtatag4080

seq          CCCCCCCCATGGCCCCCCGCTCGCTGAGCCGCCGATCATTGGTACCCGGAAAATGCGGGG428

  • ■ kit             ititititit itit it it itititititit itititit it it it it it it it it it it it it it it it it itititit

    GPAT         gcgacaagggatgtgccgccgacttgtagatggaatcgaaatgatcctcagctctctcaa4140

seq          GCGACAAGGGATGTCCCGACGACACGTAGATGGAATCGAAATGATCCTCGACACCCCCTG488

  • ★    ★★★★★★★★★★★★★ ititit it it it it it it it it it it it it it it it it it it it it it it it it it it it it it it it it

    GPAT         tgttgagaagttgatcattcctgctatcacagaacttgtggacacctggacatcgaaatt4200

seq          GGTTGAGGGGTTGCCCCTCCCGGCCGCCACCGAACTTGGGACCCGCAGGGCAC-------541

★★★★ Л     ★★ *     ♦ it irk itit ititit it it it it it it it it it it it it it it it it

Figure 3: Comparison of the nucleotide sequences of the obtained sequence (seq) of sample 2 and the maize glycerol-3-phosphate acyltransferase (GPAT) mRNA, indicating the homology of the conserved NAT_SF domain. * -nucleotide matching.

miR775A ------------------------------------UUCGAUGUCUAGCAGUGCCAA---21

GPAT         a gagcag tatca tgaagc ctgctctcctgaga ctgattcc ata a ct aacct tgccaa tca€0

30g          ----------------------------------------------------GCCCAGCC 8

miR775A  21

GPAT         tgttgagaagttgatcattcctgctatcacagaacttgtggacacctggacatcgaaatt€00

aeq          GGTTGAGGGGCGGCCCCACCCGGCCGCCACCCCCCTTGGGACCCGCAGGGCAC 541

Figure 4: Nucleotide sequences of sequence (seq) of sample 2 and maize glycerol-3-phosphate acyltransferase (GPAT) mRNA, indicating the location of attachment of miR775A microRNA. * - nucleotide matching.

Glycerol-3-phosphatacyltransferase has different localisation in the cell: mitochondria, plasmolemma, endoplasmic reticulum. This enzyme catalyses the reaction of acyl-CoA and glycerol-3-phosphate (G3P) to form lysophosphatidic acid (LPA) and protect acyl-CoA from β-oxidation. In addition, by participating in the formation of triacylglycerides, this enzyme enables the synthesis of lipid droplets, which are responsible for intercellular signal transduction (Chen et al. , 2011).

Inhibition of glycerol-3-phosphatacyltransferase in maize leaf cells under hypoxia can probably provide changes in the rate of intra- and extracellular vesicle formation (Gallop et al. , 2005), which reflects the coordination of signalling pathways regulating cellular metabolism under stress factor action. The mechanism for this regulation of glycerol-3-phosphatacyltransferase is RNA interference involving miR775A.

CONCLUSION

One of the hypoxia-dependent microRNAs is miR775A, whose accumulation has been shown in plants under oxygen deprivation (Moldovan et al., 2009). Application of a specific fluorescent probe to miR775A has allowed assessment of the formation of RNA interfering complexes in maize leaves under hypoxia. Electrophoresis results indicate that miR775A acts via the RNA interference pathway by binding to the RISC complex and interacts posttranscriptionally with its complementary mRNA. This is evidenced by the fluorescent structures formed - triplexes representing the mRNA-miR775A-probe complex. It has been shown that at 12 h of stress exposure miR775A forms two complexes with different electrophoretic mobility. The resulting sequences of the less mobile complex 2 have showed its correspondence to glycerol-3-phosphate acyltransferase mRNA. Evaluation of RNA-interfering complex formation using a specific ROX-containing probe has showed that miR775A acts through the RNA interference pathway by binding to the RISC complex and posttranscriptionally interacts with its complementary mRNA of glycerol-3-phosphate acyltransferase, reducing the formation of apoproteins of this enzyme in maize cells under hypoxia.

CONFLICTS OF INTEREST

The authors declare that they have no potential conflicts of interest.

References Participation of MIR775A in post-transcriptional regulation glycerol-3-phosphatacyltransferases in corn leaves under hypoxia

  • Agarwal S., Grover A., (2006) Molecular Biology. Biotechnology and Genomics of Flooding-Associated Low O2 Stress Response in Plants. Crit. Rev. Plant Sci. ;25:1-21.
  • Chen X., Snyder C.L., Truksa M., Shah S., Weselake R.J. (2011) sn-Glycerol-3-phosphate acyltransferases in plants. Plant Signal Behav., 6. 1695-1699.
  • Gallop J.L., Butler P.J., McMahon H.T. (2005) Endophilin and CtBP/BARS are not acyl transferases in endocytosis or Golgi fission. Nature, 438. 675-678.
  • Hou Q., Ufer G., Bartels D. (2016) Lipid signalling in plant responses to abiotic stress. Plant Cell Environ, 39. 1029-1048.
  • Ivey K.N., Srivastava D. (2010) MicroRNAs as regulators of differentiation and cell fate decisions. Cell Stem Cell., 7, 36-41.
  • Khraiwesh B., Zhu J.K., Zhu J. (2012) Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim Biophys Acta. 1819, 137-148.
  • Lakin G.F. Biometrics. Moscow: Vysh. shkola, 1990. 351 p.
  • Lung S.C., Chye M.L. (2019) Arabidopsis acyl-CoA-binding proteins regulate the synthesis of lipid signals. New Phytol. 223, 113-117.
  • Moldovan D., Spriggs A., Yang J., Pogson B.J., Dennis E.S., Wilson I.W. (2009) Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis. J Exp Bot. 61, 165-177.
  • Neess D., Bek S., Engelsby H., Gallego S.F., F^rgeman N.J. (2015) Long-chain acyl-CoA esters in metabolism and signaling: Role of acyl-CoA binding proteins. Prog. Lipid Res., 59. 1-25.
  • Noack L.C., Jaillais Y. (2020) Functions of anionic lipids in plants. Annu Rev Plant Biol., 71. 71-102.
  • RNAs in Biotic Stress Responses. Annu. Rev. Plant Biol. 60, 485-510.
  • Schmidt R.R., Fulda M., Paul M.V., Anders M., Plum F., Weits D.A., Kosmacz M., Larson T.R., Graham I.A., Beemster G.T.S., Licausi F., Geigenberger P., Schippers J.H., van Dongen J.T. (2018) Low-oxygen response is triggered by an ATP-dependent shift in oleoyl-CoA in Arabidopsis. Proc Natl Acad Sci USA, 115. 12101-12110.
  • Seki M., Narusaka M., Ishida J., Nanjo T., Fujita M., Oono Y., Kamiya A., Nakajima M., Enju A., Sakurai T. (2002) Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J. 31, 279-292.
  • Shukla G.C., Singh J., Barik S. (2011) MicroRNAs: Processing, maturation, target recognition and regulatory functions. Mol. Cell. Pharmacol., 3, 8392.
  • Vennapusa A.R., Somayanda I.M., Doherty C.J., Jagadish S.K. (2020) A universal method for high-quality RNA extraction from plant tissues rich in starch, proteins and fiber. Sci. Rep. 10, 1-13.
  • Wang J., Chitsaz F., Derbyshire M.K., Gonzales N.R., Gwadz M., Lu S., Marchler G.H., Song J.S., Thanki N., Yamashita R.A., Yang M., Zhang D., Zheng C., Lanczycki C.J., Marchler-Bauer A. (2023) The conserved domain database in 2023. Nucleic Acids Res. 51, D384-D388.
  • Wang X. (2004) Lipid signaling. Curr Opin Plant Biol, 7. 329-336.
  • Xiao S., Chye M.L. (2011) New roles for acyl-CoA-binding proteins (ACBPs) in plant development, stress responses and lipid metabolism. Prog Lipid Res., 50. 141-151.
  • Zhang Z., Wei L., Zou X., Tao Y., Liu Z., Zheng Y. (2008) Submergence-responsive MicroRNAs are Potentially Involved in the Regulation of Morphological and Metabolic Adaptations in Maize Root Cells. Ann. Bot. 102, 509-519.
  • Zhou Y., Tan W.J., Xie L.J., Qi H., Yang Y.C., Huang L.P., Lai Y.X., Tan Y.F., Zhou D.M., Yu L.J., Chen Q.F., Chye M.L., Xiao S. (2020) Polyunsaturated linolenoyl-CoA modulates ERF-VII-mediated hypoxia signaling in Arabidopsis. J Integr Plant Biol. 62, 330-348.
  • Zhu J-K. (2002) Salt and Drought Stress Signal Transduction in Plants. Annu. Rev. Plant Biol. 53, 247-273.
More